| Gene name |
SPBC3D6.13c |
| Gene ID |
37/G11 |
| Gene synonyms/obsolete |
|
| Gene product |
glycoprotein;
thioredoxin related glycoprotein; thioredoxin domain; similar
to Sp SPAC959.05C and SPCC1840.08C (paralogs) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2181 |
| ORF length (spliced) |
|
| Entry clone length |
2181 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
663T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC3D6.13.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCGGTCAAACACCTTTGG |
| Rev primer name |
SPBC3D6.13.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATCAAACTTTCCACTGTTT |
| Amino acid length |
726 |
| Molecular weight |
81.2 |
| Isoelectric point (calc.) |
4.6 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
1 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSTSVSSLSL |
| Localization (YFP) |
Golgi |
| Comments for localization |
Golgi, especially near
site of septum formation |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica,
DeltaVision |