| Gene name |
SPBC1734.03 |
| Gene ID |
37/C06 |
| Gene synonyms/obsolete |
SPBC337.19 |
| Gene product |
dihydropteroate
synthase; 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine
diphosphokinase; 7,
8-dihydro-6-hydroxymethylpterin-pyrophosphokinase; HPPK;
dihydroneopterin aldolase; trifunctional enzyme; involved in
folate biosynthesis (1st step) (2nd step) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2061 |
| ORF length (spliced) |
|
| Entry clone length |
2061 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
11T:A / 549T:C /
977A:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC1734.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGACTTGATACATGACAC |
| Rev primer name |
SPBC1734.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGGTACGTAACGTATAGCA |
| Amino acid length |
686 |
| Molecular weight |
76.3 |
| Isoelectric point (calc.) |
6.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol; cytoplasmic
dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |