| Gene name |
SPBC17D1.01 |
| Gene ID |
37/A07 |
| Gene synonyms/obsolete |
SPBC17D11.09 |
| Gene product |
hypothetical protein;
sequence orphan |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1922 |
| ORF length (spliced) |
1755 |
| Entry clone length |
1922 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
599T:C / 1519C:T /
1543C:T |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC17D1.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAAGCTGTATATTTGGA |
| Rev primer name |
SPBC17D1.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATCACTTTTAGCAGTGCCA |
| Amino acid length |
584 |
| Molecular weight |
64.2 |
| Isoelectric point (calc.) |
6.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
217/170 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSQVMPLDL |
| Localization (YFP) |
nucleus>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal |