| Gene name |
SPAC19A8.05c |
| Gene ID |
36/G01 |
| Gene synonyms/obsolete |
vps27 |
| Gene product |
zinc finger protein;
zf-FYVE type; involved in Golgi-vacuole transport; complexed
with SPBC1734.08; sorting receptor for ubiquitinated membrane
proteins (ISS); involved in protyolysis |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1833 |
| ORF length (spliced) |
|
| Entry clone length |
1833 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
22A:G / 197A:T /
658A:G / 1274A:G / 1457T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC19A8.05.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTCGGTGGTGGAATTC |
| Rev primer name |
SPAC19A8.05.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAGCTCGATTAAAGATGCT |
| Amino acid length |
610 |
| Molecular weight |
68.2 |
| Isoelectric point (calc.) |
4.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol=nucleus |
| Comments for localization |
except nucleolus;
cytoplasmic aggregates by over expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |