| Gene name |
SPCC962.06c |
| Gene ID |
36/E11 |
| Gene synonyms/obsolete |
bpb1; sf1 |
| Gene product |
zinc finger protein;
zf-CCHC type (zinc knuckle); involved in mRNA splicing;
SF1-U2AF(59)-U2AF(23) complex; KH domain; involved in
pre-spliceosome formation |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1810 |
| ORF length (spliced) |
1764 |
| Entry clone length |
1810 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
1779T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC962.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCTGAATTCAAGGTCAGT |
| Rev primer name |
SPCC962.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATCGATTGGAATATCCGTTT |
| Amino acid length |
587 |
| Molecular weight |
63.6 |
| Isoelectric point (calc.) |
8.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nuclear dots;
nucleus>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |