| Gene name |
SPAC1039.02 |
| Gene ID |
36/E06 |
| Gene synonyms/obsolete |
|
| Gene product |
calcineurin-like
phosphoesterase; similar to Sp SPBPB2B2.06C and SPAC17G6.03
(paralogs) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1806 |
| ORF length (spliced) |
|
| Entry clone length |
1806 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
131A:G / 1370T:C /
1748G:A |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC1039.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAGTTATCATCTTTACC |
| Rev primer name |
SPAC1039.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATCACAGTAATCACTCCAT |
| Amino acid length |
601 |
| Molecular weight |
68 |
| Isoelectric point (calc.) |
4.7 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSSLPSGLGL |
| Localization (YFP) |
ER?; cytoplasmic
dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal |