| Gene name |
SPBP4H10.07 |
| Gene ID |
36/A08 |
| Gene synonyms/obsolete |
|
| Gene product |
zinc finger protein;
zf-C3HC4 type (RING finger); ubiquitin ligase (E3); similar to
Sp SPCC4G3.12C (paralog); no apparentSc ortholog |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1752 |
| ORF length (spliced) |
|
| Entry clone length |
1752 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
171A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBP4H10.07.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGGCAAGGTGAATCCAT |
| Rev primer name |
SPBP4H10.07.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGGCTTGGGAGAGGACGGA |
| Amino acid length |
583 |
| Molecular weight |
64.3 |
| Isoelectric point (calc.) |
4.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
no apparent signal
|
| Comments for localization |
vacuole and
mitochondrion? |
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
Leica,
Confocal |