| Gene name |
SPBC19G7.09 |
| Gene ID |
35/E03 |
| Gene synonyms/obsolete |
ulp1 |
| Gene product |
Ulp1 protease family;
peptidase family C48; cysteine protease; Pmt3 (SUMO)-specific
protease; involved in protein deubiquitination and protein
desumoylation; non-essential; involved in nuclear morphology
maintenance |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1707 |
| ORF length (spliced) |
|
| Entry clone length |
1707 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
266A:G |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC19G7.09.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGATAGGAAAACGCAATGC |
| Rev primer name |
SPBC19G7.09.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATAGATTTGTGCATCAATA |
| Amino acid length |
568 |
| Molecular weight |
64.9 |
| Isoelectric point (calc.) |
9.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
23 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nuclear envelope;
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |