| Gene name |
SPAC1B3.16c |
| Gene ID |
35/E01 |
| Gene synonyms/obsolete |
|
| Gene product |
vitamin H transporter;
MFS transporter; biotin transporter; plasma membrane; tandem
duplication; similar to Sp SPAC1B3.16c; functionally
complements Sc VHT1; allantoate permease family |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1707 |
| ORF length (spliced) |
|
| Entry clone length |
1707 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC1B3.16.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCTTCAGAATGGCCTGA |
| Rev primer name |
SPAC1B3.16.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGCGTCAGCCTGTTGGGAA |
| Amino acid length |
568 |
| Molecular weight |
62.8 |
| Isoelectric point (calc.) |
8 |
| Signal SEQ |
|
| No. of transmembrane domain |
12 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LRRLQKLRL/LRIIPCLWI |
| Localization (YFP) |
Golgi; periphery |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |