| Gene name |
SPCC962.05 |
| Gene ID |
35/B08 |
| Gene synonyms/obsolete |
|
| Gene product |
hypothetical protein;
sequence orphan |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1680 |
| ORF length (spliced) |
1611 |
| Entry clone length |
1680 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
221A:G / 928A:C /
1037C:T / 1079T:C / 1509A:T |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC962.05.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGAGTACCTCGATTGGG |
| Rev primer name |
SPCC962.05.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGATTGATCTTTTTTAGTC |
| Amino acid length |
536 |
| Molecular weight |
61.8 |
| Isoelectric point (calc.) |
6.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
526 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol;
mitochondrion |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |