| Gene name |
SPAC30D11.08c |
| Gene ID |
34/H08 |
| Gene synonyms/obsolete |
|
| Gene product |
zinc finger protein;
zf-PHD finger; involved in transcriptional regulation; similar
to Sp SPCC4G3.07C (paralog) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1666 |
| ORF length (spliced) |
1617 |
| Entry clone length |
1666 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
314A:T / 515A:G /
1371T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC30D11.08.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCCGAATTCATCGTACTA |
| Rev primer name |
SPAC30D11.08.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAATACTACTAAGAACAATT |
| Amino acid length |
538 |
| Molecular weight |
60.6 |
| Isoelectric point (calc.) |
5.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus; nuclear
dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica,
DeltaVision |