| Gene name |
SPBC19G7.06 |
| Gene ID |
34/H04 |
| Gene synonyms/obsolete |
|
| Gene product |
MAD box transcription
factor; no apparent Sc ortholog |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1664 |
| ORF length (spliced) |
1311 |
| Entry clone length |
1664 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
516G:A / 1502G:C /
1513T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC19G7.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATATTAATCCTCCTCC |
| Rev primer name |
SPBC19G7.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGGGGCATTTCGTTCAATA |
| Amino acid length |
436 |
| Molecular weight |
48.3 |
| Isoelectric point (calc.) |
5.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
intranuclear microtubule bundle (nucleus>>cytosol;
nuclear dots) |
| Microscope used for
observation |
Leica |