| Gene name |
SPAC31A2.10 |
| Gene ID |
34/H01 |
| Gene synonyms/obsolete |
|
| Gene product |
RanGTP-binding
protein; similar to Sp SPCC584.03C (paralog) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1664 |
| ORF length (spliced) |
1383 |
| Entry clone length |
1664 |
| No. of intron |
4 |
| Sequence status |
Finished |
| Sequence results |
1097T:C /
1565G:A |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC31A2.10.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGACCAAGTTTTATCGAA |
| Rev primer name |
SPAC31A2.10.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGTTACTATTCAACATCGCA |
| Amino acid length |
460 |
| Molecular weight |
51.3 |
| Isoelectric point (calc.) |
4.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LQNLVPLII/LSLLEYLLRL |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
nucleus>cytosol |
| Microscope used for
observation |
Leica |