| Gene name |
SPBC409.08 |
| Gene ID |
34/G11 |
| Gene synonyms/obsolete |
|
| Gene product |
membrane transporter;
unknown specificity |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1662 |
| ORF length (spliced) |
1620 |
| Entry clone length |
1662 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
57A:G / 1293T:A /
1321A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC409.08.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCCTTTGGAAAAGACAAA |
| Rev primer name |
SPBC409.08.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAACAATAGCGGCCTTGGAT |
| Amino acid length |
539 |
| Molecular weight |
59.7 |
| Isoelectric point (calc.) |
5.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
12 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LAPNIACLLI |
| Localization (YFP) |
no apparent signal
|
| Comments for localization |
vacuole;
periphery? |
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
Confocal |