| Gene name |
SPAC11D3.08c |
| Gene ID |
34/F10 |
| Gene synonyms/obsolete |
|
| Gene product |
amino acid permease
familysimilar to Sp SPBC15C4.04C and SPAPB24D3.02C and
SPCC74.04 and SPAC1039.01 and SPCC584.13 and SPAC9.10 and
SPCC794.03 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1653 |
| ORF length (spliced) |
|
| Entry clone length |
1653 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
44A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC11D3.08.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTGACATCGACAAAGA |
| Rev primer name |
SPAC11D3.08.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTCTGTGATTTGCTTCTGG |
| Amino acid length |
550 |
| Molecular weight |
59.9 |
| Isoelectric point (calc.) |
5.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
12 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LGIFSLLVI/LLYSLLVGLLI |
| Localization (YFP) |
cytoplasmic dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |