| Gene name |
SPCC794.04c |
| Gene ID |
34/E11 |
| Gene synonyms/obsolete |
|
| Gene product |
unknown specificity;
transporter; similar to Sp SPAC11D3.05 and SPBC530.15C and
SPCC569.05C and SPBC36.03C and SPBC36.01C and SPBC36.02C and
SPBC530.02 and SPBC947.06C; involved in amine/polyamine
transport |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1644 |
| ORF length (spliced) |
|
| Entry clone length |
1644 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
657T:C / 1200T:C /
1335G:A |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC794.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATTACATTTTCTTAAT |
| Rev primer name |
SPCC794.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATCCTTTATAAGCATGAGGA |
| Amino acid length |
547 |
| Molecular weight |
61.7 |
| Isoelectric point (calc.) |
7.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSEVYGRLPL/LVFINILLYI/LGILVGILLGL |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
Confocal |