| Gene name |
SPBC15D4.02 |
| Gene ID |
34/E09 |
| Gene synonyms/obsolete |
|
| Gene product |
zinc finger protein;
zf-fungal Zn(2)-Cys(6) binuclear cluster domain; involved in
transcriptional regulation; no apparent Sc ortholog |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1644 |
| ORF length (spliced) |
|
| Entry clone length |
1644 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
36A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC15D4.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAGTATCATCCTTCTTC |
| Rev primer name |
SPBC15D4.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTGACAACCAATGGCTAAA |
| Amino acid length |
547 |
| Molecular weight |
59.6 |
| Isoelectric point (calc.) |
8.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
166 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLAVTQLYI/LASGLNPLPL/LDESLFHLGL/LPRLALLMI |
| Localization (YFP) |
nucleus |
| Comments for localization |
nuclear dots by over
expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |