| Gene name |
SPAC16E8.13 |
| Gene ID |
34/E05 |
| Gene synonyms/obsolete |
|
| Gene product |
conserved
hypothetical; zinc finger protein; zf-C3HC4 type (RING
finger); ubiquitin ligase (E3); zf-UBP type; human breast
cancer-associated protein BRAP2 protein human |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1644 |
| ORF length (spliced) |
|
| Entry clone length |
1644 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
448G:A / 1535T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC16E8.13.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTATTACTACTTAGAAAT |
| Rev primer name |
SPAC16E8.13.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGTCTGTACCTAGTGAACCA |
| Amino acid length |
547 |
| Molecular weight |
61.8 |
| Isoelectric point (calc.) |
7.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSRVNEELVL |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal |