| Gene name |
SPAC19A8.09 |
| Gene ID |
34/D09 |
| Gene synonyms/obsolete |
|
| Gene product |
ER to Golgi transprot
protein; conserved eukaryotic protein; similar to S.
cerevisiae YER074W-A; 1 predicted transmembrane helix;
predicted N-terminal signal sequence |
| Entry clone |
Cloned |
| ORF length (unspliced) |
375 |
| ORF length (spliced) |
246 |
| Entry clone length |
375 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC19A8.09.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTTGGGTTTGGAAATAT |
| Rev primer name |
SPAC19A8.09.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATCCCAAGACGAGGTTATAA |
| Amino acid length |
81 |
| Molecular weight |
9 |
| Isoelectric point (calc.) |
10.6 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
ER |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal |