| Gene name |
SPBC56F2.04 |
| Gene ID |
34/D01 |
| Gene synonyms/obsolete |
|
| Gene product |
similar to human DRIM,
a protein differentially produced in metastatic and
nonmetastatic human breast carcinoma cells |
| Entry clone |
Cloned |
| ORF length (unspliced) |
7631 |
| ORF length (spliced) |
7482 |
| Entry clone length |
7631 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
1576T:G / 2232T:C /
2845T:C / 4483A:G / 6162T:G / 6609A:G / 7595T:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC56F2.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAAGCTGCGGCGCAGAG |
| Rev primer name |
SPBC56F2.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACCTATTTTTAAAAATTGAA |
| Amino acid length |
2493 |
| Molecular weight |
285.2 |
| Isoelectric point (calc.) |
6.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLTQFARDLAL/LQRKVSRLFL/LHALLGLTI/LAIIYSWLSL/LEKLPTLEI/LSLKVFLLFL/LLYILDTLNL/LTNDFFPTLML/LGYTVHYLLL/LRFLVLLLPL |
| Localization (YFP) |
nucleolus>nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |