| Gene name |
SPAC4F8.12c |
| Gene ID |
34/C11 |
| Gene synonyms/obsolete |
spp42; cwf6 |
| Gene product |
Status U5
snRNA-associated splicing factor; involved in mRNA splicing;
complexed with Cdc5p |
| Entry clone |
#Not cloned yet |
| ORF length (unspliced) |
7092 |
| ORF length (spliced) |
|
| Entry clone length |
7092 |
| No. of intron |
0 |
| Sequence status |
#Not cloned yet |
| Sequence results |
#Not cloned/serious
mutation |
| Comments |
|
| Polymerase used for cloning |
|
| Fwd primer name |
SPAC4F8.12.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCGTCGTTACCACCGGG |
| Rev primer name |
SPAC4F8.12.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGCAAATGCATCTGGCATA |
| Amino acid length |
2363 |
| Molecular weight |
274.5 |
| Isoelectric point (calc.) |
9.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LGRLTRLWL/LVLDLLILGL/LDQELESLQI/LRERIRKGLQL/LDKINDLIL |
| Localization (YFP) |
not cloned |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
|