| Gene name |
SPBC27B12.08 |
| Gene ID |
34/B08 |
| Gene synonyms/obsolete |
|
| Gene product |
conserved
hypothetical; HEAT repeat (inferred from context) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
6098 |
| ORF length (spliced) |
5760 |
| Entry clone length |
6098 |
| No. of intron |
8 |
| Sequence status |
Finished |
| Sequence results |
299T:C / 1235G:A /
1950T:C / 2472T:C / 3209A:G / 3267T:C / 3687A:G / 5484A:G /
5743T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC27B12.08.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCGTTAGCATCATTGCC |
| Rev primer name |
SPBC27B12.08.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTCAACATTTTGTATTAAG |
| Amino acid length |
1919 |
| Molecular weight |
217.6 |
| Isoelectric point (calc.) |
6.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
1090 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LQTNLNPLLSL/LVFAVKHLFL/LDTTLQILYL/LLALFNRLEL/LNVGIFNNLTL/LPDKVVSLMI/LFQLVKILTL |
| Localization (YFP) |
Golgi;
nucleus>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |