| Gene name |
SPBC4C3.05c |
| Gene ID |
34/B06 |
| Gene synonyms/obsolete |
nuc1; rpa1;
SPBC4C3.05a |
| Gene product |
DNA-directed RNA
polymerase I (large subunit); involved in the formation of the
nucleolus (required) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
5070 |
| ORF length (spliced) |
|
| Entry clone length |
5070 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
475A:G / 857A:T /
2283T:C / 4749T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC4C3.05a.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAATATTGCACAGCCAGT |
| Rev primer name |
SPBC4C3.05a.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGTTTGCAGGAGAATCGACT |
| Amino acid length |
1689 |
| Molecular weight |
189.2 |
| Isoelectric point (calc.) |
6.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LISLMPLTI |
| Localization (YFP) |
cytosol; ambiguous
structure |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |