| Gene name |
SPBC26H8.10 |
| Gene ID |
34/A05 |
| Gene synonyms/obsolete |
dis3 |
| Gene product |
involved in the
regulation of mitosis; involved in anaphase (required);
exosome (RNase complex); 3'-5' exoribonuclease; involved in
rRNA processing; essential; RNB domain; ribonuclease family
signature; possibly binds directly to Ran and enhances the GEF
activity of SPAC10F6.04 (check) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3077 |
| ORF length (spliced) |
2913 |
| Entry clone length |
3077 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
1983A:G /
2534A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC26H8.10.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGCACTGTTTCAGGATT |
| Rev primer name |
SPBC26H8.10.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATACACCAAAGTAATCTGG |
| Amino acid length |
970 |
| Molecular weight |
110.1 |
| Isoelectric point (calc.) |
6.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LTQGMRVLLKL |
| Localization (YFP) |
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal |