| Gene name |
SPBC4.04c |
| Gene ID |
33/H09 |
| Gene synonyms/obsolete |
mcm2; nda1;
cdc19 |
| Gene product |
MCM complex subunit;
involved in DNA replication (initiation) (required); involved
in cytokinesis (required); involved in septation (required);
expression peaks at M-G1 phase; regulated by PBF transcription
complex |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2712 |
| ORF length (spliced) |
2493 |
| Entry clone length |
2712 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
556G:A / 1127G:A /
1813T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC4.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATTCTTTTCGGAAAAG |
| Rev primer name |
SPBC4.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAATAAGATATTTAGCAAAT |
| Amino acid length |
830 |
| Molecular weight |
92.8 |
| Isoelectric point (calc.) |
4.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
nucleus>>cytosol |
| Microscope used for
observation |
DeltaVision |