| Gene name |
SPBC1703.14c |
| Gene ID |
33/H03 |
| Gene synonyms/obsolete |
top1 |
| Gene product |
DNA topoisomerase
activity; non-essential; involved in establishment and/or
maintenance of chromatin architecture |
| Entry clone |
Cloned# |
| ORF length (unspliced) |
2544 |
| ORF length (spliced) |
2445 |
| Entry clone length |
2544 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC1703.14.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTTCGTCTGGTAAGGT |
| Rev primer name |
SPBC1703.14.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACCACTTCCAATCCGGAGGT |
| Amino acid length |
814 |
| Molecular weight |
93.9 |
| Isoelectric point (calc.) |
9.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
14 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKKMPKNLTL |
| Localization (YFP) |
nucleolus>nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Zeiss |