| Gene name |
SPBC342.05 |
| Gene ID |
33/G08 |
| Gene synonyms/obsolete |
rhp9; crb2 |
| Gene product |
involved in DNA damage
checkpoint; BRCT domain |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2337 |
| ORF length (spliced) |
|
| Entry clone length |
2337 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
417G:A / 645A:G /
1546C:T |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC342.05.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAGGTGAATGATACCTC |
| Rev primer name |
SPBC342.05.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGTAGAAATATCAGACTGA |
| Amino acid length |
778 |
| Molecular weight |
87.4 |
| Isoelectric point (calc.) |
8.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LAHVYHALAL |
| Localization (YFP) |
nucleus |
| Comments for localization |
nuclear dots by over
expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |