| Gene name |
SPBC8D2.10c |
| Gene ID |
33/F05 |
| Gene synonyms/obsolete |
|
| Gene product |
zinc finger protein
(inferred from context); zf-C2H2 type; arginine
N-methyltransferase; no apparent Sc ortholog (has
homologs) |
| Entry clone |
Cloned in 2004
trial |
| ORF length (unspliced) |
2025 |
| ORF length (spliced) |
1632 |
| Entry clone length |
2025 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC8D2.10.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTAGTGAAACCTATGGC |
| Rev primer name |
SPBC8D2.10.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATTCAACACGTAGCTTTGA |
| Amino acid length |
543 |
| Molecular weight |
61.7 |
| Isoelectric point (calc.) |
4.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
nucleus>cytosol |
| Microscope used for
observation |
DeltaVision |