Gene name |
SPBC1347.10 |
Gene ID |
33/D07 |
Gene synonyms/obsolete |
cdc23 |
Gene product |
MCM-associated
protein; involved in DNA replication (initiation) (required);
essential; OB-fold nucleic acid binding domain; interacts
physically with Mcm4p; interacts physically with Mcm5p;
interacts physically with Mcm6p; interacts physically with
Orc1p; interacts physically with Orc2p; interacts physically
with Orc5p; interacts physically with Orc6p |
Entry clone |
Cloned |
ORF length (unspliced) |
1782 |
ORF length (spliced) |
|
Entry clone length |
1782 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC1347.10.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCATGATCCCTTCATTGC |
Rev primer name |
SPBC1347.10.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGGGAACTATTTCTAAGTCA |
Amino acid length |
593 |
Molecular weight |
66.6 |
Isoelectric point (calc.) |
9.9 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
spindle microtubules;
nucleus; bright nuclear dots |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |