| Gene name |
SPBC26H8.07c |
| Gene ID |
33/C09 |
| Gene synonyms/obsolete |
nda3; ben1;
alp12 |
| Gene product |
beta tubulin; involved
in control of microtubular organization; involved in
sensitivity to anti-mitotic benzimidazole compounds |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1649 |
| ORF length (spliced) |
1347 |
| Entry clone length |
1649 |
| No. of intron |
5 |
| Sequence status |
Finished |
| Sequence results |
1368G:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC26H8.07.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCGTGAGATTGTACGAGC |
| Rev primer name |
SPBC26H8.07.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATACTCGAGAGGCTCCTTC |
| Amino acid length |
448 |
| Molecular weight |
49.4 |
| Isoelectric point (calc.) |
4.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSSIFANTLKI |
| Localization (YFP) |
cytosol |
| Comments for localization |
cytoplasmic dots and
aggregates by over expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |