| Gene name |
SPAC23G3.06 |
| Gene ID |
33/C07 |
| Gene synonyms/obsolete |
|
| Gene product |
ribonucleoprotein
complex; processome component; involved in rRNA processing;
involved in ribosome biogenesis and assembly; snoRNA-binding
protein |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1636 |
| ORF length (spliced) |
1527 |
| Entry clone length |
1636 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
281A:G / 1293A:G /
1627A:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC23G3.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTTATTCTTACTGGTAT |
| Rev primer name |
SPAC23G3.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATCCTTTGACTTTTTGGAC |
| Amino acid length |
508 |
| Molecular weight |
55.7 |
| Isoelectric point (calc.) |
9.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
496/453/484/472/17 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleolus>>nucleus; nucleolar dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |