| Gene name |
SPAC630.03 |
| Gene ID |
33/C01 |
| Gene synonyms/obsolete |
act2 |
| Gene product |
ARP2/3
actin-organizing complex; involved in actin cortical patch
assembly; actin-like protein; essential; involved in cell
polarity; involved in endocytosis; actin cortical patch
component; interacts genetically with Cdc3p; essential |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1579 |
| ORF length (spliced) |
1284 |
| Entry clone length |
1579 |
| No. of intron |
4 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC630.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCTTCGTTTAATGTTCC |
| Rev primer name |
SPAC630.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAGAGAATTTCCAAAAATT |
| Amino acid length |
427 |
| Molecular weight |
47.3 |
| Isoelectric point (calc.) |
6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LYIAVQAVLAL |
| Localization (YFP) |
cytoplasmic dots;
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |