| Gene name |
SPBC16A3.05c |
| Gene ID |
33/B04 |
| Gene synonyms/obsolete |
rae1 |
| Gene product |
WD repeat protein;
poly(A)+ RNA export protein; nuclear pore complex; involved in
nuclear import; involved in nuclear export; involved in
nuclear export of the small ribosomal subunit; interacts
physically with Mex67p (in RNA export); involved in mitotic
progression (required) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1528 |
| ORF length (spliced) |
1059 |
| Entry clone length |
1528 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
39T:C / 176A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC16A3.05.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCACTTTTTGGACAGGC |
| Rev primer name |
SPBC16A3.05.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACCTTCCTTTCTTAGGTCGA |
| Amino acid length |
352 |
| Molecular weight |
38.6 |
| Isoelectric point (calc.) |
8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nuclear envelope
|
| Comments for localization |
SPB? |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |