| Gene name |
SPBC8D2.17 |
| Gene ID |
32/D07 |
| Gene synonyms/obsolete |
|
| Gene product |
alpha-1,2-galactosyltransferase; GMA12/MNN10 family;
predicted N-terminal signal sequence; similar to S. pombe gmh1
and gmh3 and gmh2 and gma12 and SPAC5H10.13C and SPBC1289.13c
and SPAC637.06 paralogs |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1056 |
| ORF length (spliced) |
|
| Entry clone length |
1056 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
937T:C / 953T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC8D2.17.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTCAACTTTCGTTTATT |
| Rev primer name |
SPBC8D2.17.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGACAGTACTAACCTACGA |
| Amino acid length |
351 |
| Molecular weight |
39.7 |
| Isoelectric point (calc.) |
9.2 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
1 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LGLLAIVLLL |
| Localization (YFP) |
ER |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |