| Gene name |
SPBC8D2.14c |
| Gene ID |
32/C11 |
| Gene synonyms/obsolete |
sed5 |
| Gene product |
SNARE; Required for
vesicular transport between the endoplasmic reticulum and the
Golgi complex; Acts as a target organelle soluble NSF
attachment protein receptor (t-SNARE) (By similarity); Belongs
to the syntaxin/epimorphin family; Contains 1 t-SNARE
coiled-coil homology domain. 1 predicted transmembrane helix;
similar to S. cerevisiae YLR026C |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1021 |
| ORF length (spliced) |
930 |
| Entry clone length |
1021 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
946T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC8D2.14.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCATTTCAAGATAGGAC |
| Rev primer name |
SPBC8D2.14.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGTAACGAGCACCCAAAGA |
| Amino acid length |
309 |
| Molecular weight |
34.8 |
| Isoelectric point (calc.) |
8.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
1 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
almost no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
Leica |