| Gene name |
SPBC31A8.01c |
| Gene ID |
32/B04 |
| Gene synonyms/obsolete |
cwl1; rtn1;
SPBC651.13c |
| Gene product |
reticulon-like
protein; overexpression results in cell lysis |
| Entry clone |
Cloned |
| ORF length (unspliced) |
927 |
| ORF length (spliced) |
|
| Entry clone length |
927 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC31A8.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTGAACAACATTCATT |
| Rev primer name |
SPBC31A8.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTTGTTAACAGTGGTGTTT |
| Amino acid length |
308 |
| Molecular weight |
33.6 |
| Isoelectric point (calc.) |
7.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
3 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
291 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
Leica |