| Gene name |
SPAC1834.02 |
| Gene ID |
31/A02 |
| Gene synonyms/obsolete |
aro1 |
| Gene product |
pentafunctional
aromatic polypeptide; involved in aromatic amino acid
biosynthesis; 3-dehydroquinate synthase; 3-phosphoshikimate
1-carboxyvinyltransferase; shikimate kinase |
| Entry clone |
Cloned |
| ORF length (unspliced) |
4722 |
| ORF length (spliced) |
|
| Entry clone length |
4722 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
107T:C / 415A:G /
530T:G / 665A:G / 3387T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC1834.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCAAACGAATCTAATAT |
| Rev primer name |
SPAC1834.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTCAATAACCTTTTGATAA |
| Amino acid length |
1573 |
| Molecular weight |
173.7 |
| Isoelectric point (calc.) |
6.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
1 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |