Gene name |
SPCC645.05c |
Gene ID |
30/H12 |
Gene synonyms/obsolete |
myo2 |
Gene product |
myosin II; IQ domain;
essential; involved in contractile ring assembly; involved in
cytokinesis; regulated by phosphorylation of a C-terminal
coiled-coil domain; requires a functional septation initiation
network; interacts physically with Rlc1p |
Entry clone |
Cloned |
ORF length (unspliced) |
4581 |
ORF length (spliced) |
|
Entry clone length |
4581 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
776T:G / 878A:G /
1409A:T / 2645T:C / 2720A:G / 4136A:G / 4564G:A |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC645.05.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACAGAAGTAATATCTAA |
Rev primer name |
SPCC645.05.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATGCGGCGCGCAACTCATCT |
Amino acid length |
1526 |
Molecular weight |
176.4 |
Isoelectric point (calc.) |
6.6 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
822 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKGVQELTI/LQEIHENLLL |
Localization (YFP) |
nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |