| Gene name |
SPCC584.10c |
| Gene ID |
30/F09 |
| Gene synonyms/obsolete |
SPCC188.13c |
| Gene product |
2 RNase III signature
motifs; involved in RNA interference, PTGS. the regulation of
chromatin silencing at the centromere, the regulation of
histone L9 methylation; possibly degrades double-stranded RNA;
similar to C. elegans mut-7; no apparent Sc ortholog |
| Entry clone |
Cloned |
| ORF length (unspliced) |
4125 |
| ORF length (spliced) |
|
| Entry clone length |
4125 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
264A:G / 579A:G /
3700T:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC584.10.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATATTTCAAGTTTTCT |
| Rev primer name |
SPCC584.10.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGTCAAACTTTTAACTTTT |
| Amino acid length |
1374 |
| Molecular weight |
158 |
| Isoelectric point (calc.) |
7.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LDSGLDSALKI/LSYIGFVLNL/LQSLQFVLPL |
| Localization (YFP) |
cytosol; cytoplasmic
dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |