| Gene name |
SPAC1F7.01c |
| Gene ID |
30/F06 |
| Gene synonyms/obsolete |
SPAC694.07c |
| Gene product |
involved in
establishment and/or maintenance of chromatin architecture;
SH2 domain; S1 domain; CSZ domain (SMART) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
4098 |
| ORF length (spliced) |
|
| Entry clone length |
4098 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
48A:G / 314A:G /
844A:G / 1874A:G / 2066T:C / 3270C:T |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC1F7.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTGAAAACGAAGTTGT |
| Rev primer name |
SPAC1F7.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACATCCGTCTAAAATTTTTA |
| Amino acid length |
1365 |
| Molecular weight |
157.2 |
| Isoelectric point (calc.) |
4.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
88/86/85 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LDELIVLHI |
| Localization (YFP) |
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |