| Gene name |
SPCC970.09 |
| Gene ID |
30/E09 |
| Gene synonyms/obsolete |
sec8 |
| Gene product |
involved in secretory
pathway, exocytosis, cytokinesis, cell separation |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3557 |
| ORF length (spliced) |
3267 |
| Entry clone length |
3557 |
| No. of intron |
6 |
| Sequence status |
Finished |
| Sequence results |
319A:G / 2520A:G /
3460A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC970.09.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATACCAGAGGCTATTC |
| Rev primer name |
SPCC970.09.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGGATTTTTTCTCGCACCA |
| Amino acid length |
1088 |
| Molecular weight |
124.8 |
| Isoelectric point (calc.) |
6.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LRYLEEALSL |
| Localization (YFP) |
cytosol; cytoplasmic
dots; periphery at site of septum formation |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |