| Gene name |
SPBC215.08c |
| Gene ID |
30/E04 |
| Gene synonyms/obsolete |
arg4 |
| Gene product |
carbamoyl-phosphate
synthase; involved in arginine biosynthesis, glutamate
catabolism; ATP binding domain |
| Entry clone |
Cloned; Mixture |
| ORF length (unspliced) |
3483 |
| ORF length (spliced) |
|
| Entry clone length |
3483 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
822A:C / 1319G:A /
1548T:C / 2723C:G / 3327T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC215.08.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCATTGTGGGCTACGTC |
| Rev primer name |
SPBC215.08.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAGATCATGAGATCCGATC |
| Amino acid length |
1160 |
| Molecular weight |
127.4 |
| Isoelectric point (calc.) |
6.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
mitochondrion |
| Comments for localization |
aggregates by over
expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |