| Gene name |
SPAC6G10.02c |
| Gene ID |
30/D12 |
| Gene synonyms/obsolete |
tea3 |
| Gene product |
predicted coiled-coil;
similar to Sp tea1; involved in NETO; predicted cell end
marker required to activate polarized cell growth at the
second end during NETO |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3378 |
| ORF length (spliced) |
|
| Entry clone length |
3378 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC6G10.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGTTCAAAAGGTTTTAAG |
| Rev primer name |
SPAC6G10.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACATAAATGAATGACTAAGC |
| Amino acid length |
1125 |
| Molecular weight |
127.7 |
| Isoelectric point (calc.) |
5.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LFQHVDEKLRL |
| Localization (YFP) |
cytoplasmic dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |