| Gene name |
SPCC417.07c |
| Gene ID |
30/D06 |
| Gene synonyms/obsolete |
|
| Gene product |
MT organizer;
non-essential; coiled-coil predicted; no apparent orthologs
cannot be distinguished; related to spindle components S.
pombe Pcp1p and S. cerevisiae Spc110p; involved in the
localization of gamma tubulin complex to non SPB MTOCs |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3348 |
| ORF length (spliced) |
|
| Entry clone length |
3348 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC417.07.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAAGAAAATTCCAGTGA |
| Rev primer name |
SPCC417.07.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTTATGTTCTTGTGATGAT |
| Amino acid length |
1115 |
| Molecular weight |
128.4 |
| Isoelectric point (calc.) |
4.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LVDNLAGLSL/LRKEVFGLKL |
| Localization (YFP) |
SPB; MTOCs |
| Comments for localization |
cytoplasmic dots by
over expression; MTOCs (around nucleus and site of septum
formation) |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |