Gene name |
SPBC3B9.15c |
Gene ID |
30/D02 |
Gene synonyms/obsolete |
|
Gene product |
WD repeat protein; 5
predicted transmembrane helices; predicted N-terminal signal
sequence; sterol sensing domain; no apparent S.
cerevisiae ortholog |
Entry clone |
Cloned |
ORF length (unspliced) |
3318 |
ORF length (spliced) |
3261 |
Entry clone length |
3318 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
290T:C / 2767T:C /
2818G:A |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC3B9.15.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGGATTTTTACTCTTGG |
Rev primer name |
SPBC3B9.15.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAACATCCGATGGTCCCCGAT |
Amino acid length |
1086 |
Molecular weight |
125.1 |
Isoelectric point (calc.) |
7.8 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
5 |
NLS position (Columbia Univ.
Bioinformatics Center) |
1065 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSVDIRRLEL |
Localization (YFP) |
ER |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |