| Gene name |
SPBC3B9.15c |
| Gene ID |
30/D02 |
| Gene synonyms/obsolete |
|
| Gene product |
WD repeat protein; 5
predicted transmembrane helices; predicted N-terminal signal
sequence; sterol sensing domain; no apparent S.
cerevisiae ortholog |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3318 |
| ORF length (spliced) |
3261 |
| Entry clone length |
3318 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
290T:C / 2767T:C /
2818G:A |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC3B9.15.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGGATTTTTACTCTTGG |
| Rev primer name |
SPBC3B9.15.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAACATCCGATGGTCCCCGAT |
| Amino acid length |
1086 |
| Molecular weight |
125.1 |
| Isoelectric point (calc.) |
7.8 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
5 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
1065 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSVDIRRLEL |
| Localization (YFP) |
ER |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |