| Gene name |
SPAC26A3.10 |
| Gene ID |
30/A07 |
| Gene synonyms/obsolete |
|
| Gene product |
ADP-ribosylation
factor; GTPase activating protein; ArfGap domain; pleckstrin
homology domain; similar to Sp csx2; no apparent Sc ortholog
|
| Entry clone |
Cloned |
| ORF length (unspliced) |
3101 |
| ORF length (spliced) |
2772 |
| Entry clone length |
3101 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
950T:C / 3044T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC26A3.10.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGACGGAAGTGACTGTAT |
| Rev primer name |
SPAC26A3.10.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTCTTTCAAATACTTTGTA |
| Amino acid length |
923 |
| Molecular weight |
104.4 |
| Isoelectric point (calc.) |
8.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LPNLQQLNL/LELLFMNGLLL |
| Localization (YFP) |
periphery at cell tip
and site of septum formation; cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |