| Gene name |
SPAC20G8.05c |
| Gene ID |
30/A01 |
| Gene synonyms/obsolete |
cdc15 |
| Gene product |
phosphoprotein;
essential; involved in cytokinesis, septation,reorganization
of F-actin at mitosis; similar to Sp SPBC11C11.02 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3089 |
| ORF length (spliced) |
2784 |
| Entry clone length |
3089 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
2333G:T /
2476T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC20G8.05.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAGGTTAATGGAGTCTC |
| Rev primer name |
SPAC20G8.05.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATACCGTCTGAACAAAGTTC |
| Amino acid length |
927 |
| Molecular weight |
102.1 |
| Isoelectric point (calc.) |
6.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
periphery at cell tip
and site of septum formation |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |