| Gene name |
SPAC2G11.14 |
| Gene ID |
29/H11 |
| Gene synonyms/obsolete |
|
| Gene product |
transcription
initiation factor TFIID subunit; zinc finger protein; zf-CCHC
type (zinc knuckle) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3068 |
| ORF length (spliced) |
2940 |
| Entry clone length |
3068 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
1686T:deletion /
2302A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC2G11.14.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTTTTGATGGTCTTAT |
| Rev primer name |
SPAC2G11.14.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGTTTTTGTCGAGCATAGTA |
| Amino acid length |
979 |
| Molecular weight |
111 |
| Isoelectric point (calc.) |
6.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
902 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
Confocal
|