| Gene name |
SPAC821.09 |
| Gene ID |
29/H08 |
| Gene synonyms/obsolete |
eng1 |
| Gene product |
glycosyl hydrolase
family 81; endo-1,3-beta-glucanase; involved in septation;
involved in cytokinesis; involved in cell separation;
non-essential; GPI anchored protein; glycoprotein; regulated
by Ace2p; similar to Sp eng2 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3051 |
| ORF length (spliced) |
|
| Entry clone length |
3051 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
250A:G / 3001T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC821.09.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTTCCTATTTACGTTC |
| Rev primer name |
SPAC821.09.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGCAGCAACAAGTGCACCA |
| Amino acid length |
1016 |
| Molecular weight |
109.7 |
| Isoelectric point (calc.) |
3.9 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LRSFIFGLLTI |
| Localization (YFP) |
ambiguous
structure |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |