| Gene name |
SPCC1183.11 |
| Gene ID |
29/H05 |
| Gene synonyms/obsolete |
SPCC31H12.01 |
| Gene product |
MS ion channel; EF
hand motif; no apparent Sc ortholog; similar to Sp SPAC2C4.17C
(paralog) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3036 |
| ORF length (spliced) |
|
| Entry clone length |
3036 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
1406T:C /
2146A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC1183.11.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTTCTCCTACTTCTCC |
| Rev primer name |
SPCC1183.11.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAGTCGAGCAGACTTAGAA |
| Amino acid length |
1011 |
| Molecular weight |
114.2 |
| Isoelectric point (calc.) |
7.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
6 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LAVYVSFLPI/LQQIEQLRI/LMTYMQELDI |
| Localization (YFP) |
ER |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |